is DNA stupid?



A quick look at his web page shows that he has already managed to pick a bunch of fights with a bunch of folks.
Let's do a quick test to see whether he can admit that he is wrong (something that I do all of the time)...
"e7" wrote:
e7: "The trouble is, as an information technologist, e7: I have to invoke here Shannon's theory of e7: information, and say its impossible for 20,000 bits of e7: information to make up a human personality."
but Guy Macon says:
Guy: "The human genome has billions of bits of information, Guy: not 20,000. You are factually incorrect"
Could Guy possibly have remembered incorrectly? Let's check: http://www.google.com/search?q=%22human+genome%22+%22billion+bits%22
Nope! The figure is 23 pairs of chromosomes, roughly a hundred thousand genes, 2.9 billion base pairs, 5.8 billion bits of information.
(Took me a few minutes to figure out that the biologists are calling a base pair a "bit of information" while we computer types know that information theory shows that CACCGTGACACGTATGCCAGTAAGCAAG has the same information as 01000101101110000100011011001110010100101100001001000010 or 45B846CE52C242.)
Now for the test. Will e7 admit that he was wrong?
Enquiring minds want to know!
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload
Guy Macon <http://www.guymacon.com says...

Looks like we have our answer. He cannot admit that he was wrong.
How do people *learn* without admitting mistakes and learning from them? I get things wrong all of the time, and I *welcome* it whan someone more knowledgable corrects me. Nobody is an expert at everything
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload
The thing that everybody seems to have missed is that DNA does not encode the data that is a personality. It is the data (blueprint) for the computer, storage system, and mobility system that contain and move the personality about (the mind and body). Personality is 'stored' in the brain. Thinking (processor power) is also in the brain, while motor control is partly in the brain and partly in the 'short path' nervious system (reflexes).
The homosapien mobile computing system is delivered (literally) with only a basic boot strap program designed to carry on the most basic of self maintainence, sensor, and motor operations. This boot strap program is however being run on a massively parallel nural network learning computer with mutiple sensor subprocessors whose only purpose for it's first 157680 hours of operation is survival and learning.
Trying to compare this to current computing models is rediculess. If we are to ever build a human equivalent robot we are going to have to up processing power considerably AND develope an operating system that can distribute processor load over multiple parallel processors (on demend) while maintaining data integraty and interprocess data exchange. That system will also have to be self programing AND self debuging and the processor load for those function will also have to be accomodated.
It is currently believed that a great deal of this programing and debuging, along with data compilation and the biological equivalents of degragmenting, deleting of extranious data, and compressing are done while we sleep.
The biological equivalent of a bit is not a DNA pair. It is one nerve juntion on one nerve cell in the brain or central nervious system. A biological byte might be all the connections to a single nerve cell or it might be one (relative) position in the connections of many nerve cells. As the brain is self organizing in both memory storage and processor allocations it has proven to be very hard to translate that information into other media.
DNA is closer to the CAD/CAM file that is used to assemble a machine (in this case a person) than it is to the human personality, which would be more analigus to the output of mutiple data processing programs. People judge other people more by the perceved behavior of the entire system, data comunications (speach), movement, ect. than by any one factor. So perceved personally is more like the output of the system than any one part of that system.
Charles L.
"Guy Macon" <http://www.guymacon.com wrote in message

base
as
45B846CE52C242.)
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload
Charles Prevatte wrote:

Read up other threads - nobody missed it. According to Chomsky, 95% of the personality is built in - there isn't enough input from anywhere and the time to learn all of it by the time a child reaches age 2. If you disagree with that, you would have to knock down Chomsky result first.

It would all be so simple if Chomsky's result is negated.

That is a picture, but consider from a robotic engineer's point of view. You are given a long tape with AGCT as the only symbols written on it. From that, you must construct a human being. The first things we have to look for is the machine construction itself. That seems to be OK. We know how to read DNA and make proteins that then make structures, that then make the complete organism through concentration gradients and so on. However, to recap the story of the human genome project, it came as a great shock that the human genome doesn't seem to contain the blueprints for the software. With 100 billion neurons and 10,000 connections per neuron to program up, and Chomsky's result that 95% is already programmed up at birth, you can see the shock in the human genome camp.
The question now is whether DNA is stupid and doesn't contain this information, or that it is so clever in encryption, that we haven't found where personality is stored on the genome. Further more, the genes themselves cannot be altered to pass on information. Even a single change could result in death. More difficulty is the genes themselves. You can't read out bits of it - the complete gene must be read out and turned into a protein. This results in great information loss. Effectively, you only have 20,000 proteins to make the brain. To confound the problem even further, 99% of these proteins are the same as in a chimp.
Even to say the boot strap program is pre-loaded is making the assumption that you know where that software is stored in the DNA. But to discourage you persuing that simple avenue is Chomsky again saying that a whopping 95% is already pre-programmed. The software contains nearly the complete program - not just a bootstrap program. Each protein may be responsible for some information storage of personality - but that is a giant leap of faith considering they are randomly interacting molecules. Thus they end up being modelled as bit and you have 20,000 bits of information to play with to make a human being.
I downloaded the entire genome onto one CD. I've downloaded rasmol if I need it to view it. But where to next?

Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload
e7 wrote:

Which "Chomsky result" do you mean? Citation please. He's made a lot of wild claims in addition to his more solid work. I'm pretty sure that the result you're talking about _has_ been disproved already, but without knowing which one you're referring to it's impossible to say.
For an introduction to a few of the alternatives to and debunkings of Chomsky's ideas, I recommend the works of George Lakoff. For example:
"Women, Fire, and Dangerous Things" (Amazon.com product link shortened)
"Philosophy in the Flesh" (Amazon.com product link shortened)
There are other theories than the (untenable) one that all experience must be hard-wired at birth.
--
Carl Burke
snipped-for-privacy@mitre.org
  Click to see the full signature.
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload
Carl Burke wrote:

http://en.wikipedia.org/wiki/Noam_Chomsky
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload
The point that you are still missing blatantly is that those 20,000 genes are a blueprint for a computer called the brain. And, just as a blueprint for a PC cannot possibly presuppose what data might be stored in the PC one day, the blueprint for our brains does not presuppose what sort of things we might imagine in any realistic way. There are blueprints for image processing, linguistic processing, symbolics, reflexes, etc., but NONE of that does more than generally points us in a direction. This is identical with the conditions of having the drawings for making a graphics card, a sound card, a hard drive, etc.
Cheers!
Sir Charles W. Shults III, K. B. B. Xenotech Research 321-206-1840
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload
Sir Charles W. Shults III wrote:

If you read the other threads, this is a repeating the arguments, if true then great, but according to Chomsky, the brain is pre-programmed with 95% of the software - but there is no information in the blueprint as to how this should be done.
You have to demolish Chomsky before you can claim it is *just* a blueprint.
J
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload

They are being repeated because you math is wrong and you refuse to address your blatent errors.
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload
Guy Macon <http://www.guymacon.com wrote:

You haven't addressed Chomsky's result yet.
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload

Nor will I until you own up to your math errors. I am convinced that you are a person who never admits that he is wrong, and that your claim that the human genome has 20,000 bits of information in it when it actually has 3 billion bits of information in it is proof that you are a person who never admits that he is wrong. If you refuse to admit such an obvious and stupid error, what's the use in addressing Chomsky's argument? (It's an argument, not a result, BTW. Chomsky couldn't do a proper scientific experiment to save his life.)
Your math is wrong. You aren't fooling anyone. Admit your error and make your arguments with the real numbers instead of the ones you made up.
--
Guy Macon, Electronics Engineer & Project Manager for hire.
Remember Doc Brown from the _Back to the Future_ movies? Do you
  Click to see the full signature.
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload
Guy Macon <http://www.guymacon.com wrote:

Please just debunk Chomky's result so we can gain some insight into you.
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload
e7 wrote: [snip]

There is no need to debunk Chomsky here for three reasons:
1) You have demonstrated a complete inability to perform basic mathematical calclations, or to at least acknowledge your mistake (or if it is not a mistake, to clarify your position). This makes you look like a crank, and thus any further effort on anyone's part would likely be a supreme waste of time and energy.
2) Others in this thread have already posted links to alternative and more current theories of mind than Chomsky's, which you have apparently chosen to ignore. While these may or may not be correct, the fact that you fail to acknowledge these bodes ill for your basic credibility.
3) Chomsky is irrelevant to your argument. As others have pointed out, complex and seemingly novel systems can emerge from simple initial conditions -- a phenomena commonly termed "emergence". There is thus no need for DNA to be a "blueprint" as that word is ordinarily used. If you were actually an "information technologist" you would have at least a passing familiarity with this concept. Clearly, however, this is not the case -- thus you would (again) to appear to be a crank.
I'd go on, but I've been playing the "e7 drinking game" and am within a hair's breadth of slipping into a coma.
--
(Replies: cleanse my address of the Mark of the Beast!)

Teleoperate a roving mobile robot from the web:
  Click to see the full signature.
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload

Nope. Not until you own up to your math errors. I am right, you are wrong. That's all the insight you need.
I am convinced that you are a person who never admits that he is wrong, and that you will never admit that your claim that the human genome has 20,000 bits of information in it when it actually has 3 billion bits of information in it is bogus. If you refuse to admit such an obvious and stupid error, what's the use in addressing any of your other claims?
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload
On Thu, 08 Jul 2004 06:32:20 -0700, Guy Macon <http://www.guymacon.com wrote:

Nor should you, at all. Unless Chomsky wishes to arrive here and debate his own views.
It's the same as tilting at windmills to accept being sent off to challenge some "dead words" that cannot argue, defend, or otherwise say anything to clarify or enlighten. A "go argue with ..." is exactly the place I always leave off when trying to "have a conversation." If the person themselves isn't up to the idea of defending what they say, on their own, then that is good enough evidence for me that they don't know how and therefore don't have any idea what they are talking about.
Jon
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload
e7 wrote:

No. All one person does is have to defeat this one claim.
Your argument is simple:
1. DNA is too small to hold ther personality 2. Chomsky says that a person cannot learn what they know by the end of two years.
Therefore people can't exist.
Perhaps you should rethink your argument.
The major problem with your argument is that you keep harking on "Chomsky says". You don't look into the evidence behind his claim. You are treating his word like absolute truth. Therefore this has become, for you, a religeous argument.
If your arguments were true, then even you wouldn't have the intelligence to start this thread. If it's false, then you're just being a troll. -- D. Jay Newman
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload

Don't fall into the trap of repeating his bogus numbers. There are roughly 100,000 genes, containing billions of bit of information.
The rest of what you wrote is completely correct, but alas, the person who you are addressing is ineducable. :(
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload
Guy Macon <http://www.guymacon.com wrote:

There are 50,000 genes and 20,000 active in brain
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload

I am still waiting for you to acknowledge that your original "20,000 bits" claim was off by a factor of 150,000. Do that and you will have proved yourself to be eduacable. Prove yourself to be eduacable and I will supply documentation for my 100,000 genes figure.
--
Guy Macon, Electronics Engineer & Project Manager for hire.
Remember Doc Brown from the _Back to the Future_ movies? Do you
  Click to see the full signature.
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload

What the hell is "20,000 active in brain" supposed to mean?
Add pictures here
<% if( /^image/.test(type) ){ %>
<% } %>
<%-name%>
Add image file
Upload

Polytechforum.com is a website by engineers for engineers. It is not affiliated with any of manufacturers or vendors discussed here. All logos and trade names are the property of their respective owners.